pcw57 1 root david addgene plasmid (Addgene inc)

Addgene inc is a verified supplier

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

Addgene inc pcw57 1 root david addgene plasmid
Pcw57 1 Root David Addgene Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 395 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/david+root+addgene+plasmid/pCW57%2E1+(Plasmid+%2341393)/pm41780532-788-153-156
Average 96 stars, based on 395 article reviews

pcw57 1 root david addgene plasmid - by Bioz Stars, 2026-09

96/100 stars

Images

Recombinant:

Article Title: The interaction between NLRP1 and oxidized TRX1 involves a transient disulfide bond.
Article Snippet: %) Millipore-Sigma Cat#216763 DL-Dithiothreitol (DTT) Millipore-Sigma Cat#D9779 Iodoacetamide (IAA) Thermo Scientific Cat#A39271 N-ethylmaleimide (NEM) Thermo Scientific Cat#PI23030 G418 (Geneticin) Thermo Scientific Gibco Cat#10131035 Halt Protease Inhibitor Cocktail Thermo Scientific Cat#78430 Sequencing Grade Modified Trypsin Promega Cat#V5111 Asp-N, Sequencing Grade Promega Cat#V1621 Glu-C, Sequencing Grade Promega Cat#V1651 Critical commercial assays DC Protein Assay kit Bio-Rad Cat#5000111 MycoAlert Mycoplasma Detection Kit Lonza Cat#LT07-318 QuikChange II, Site-Directed Mutagenesis Kit Agilent Cat#200524 Deposited data Proteomics raw data This Study Accession PXD047547 (https://www.proteomexchange.org/) Experimental models: Cell lines HEK293T ATCC Cat#CRL-3216 THP-1 ATCC Cat#TIB-202 THP-1 CARD8 / Johnson et al.28 N/A THP-1 CARD8 / + pInducer20-GFP-HA This Study N/A THP-1 CARD8 / + pInducer20-NLRP1-HA This Study N/A THP-1 CARD8 / + pInducer20-NLRP1-C427S-HA This Study N/A (Continued on next page) e1 Cell Chemical Biology 31, 1–7.e1–e4, April 18, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER THP-1 CARD8 / + pInducer20-NLRP1-D413A-HA This Study N/A N/TERT-1 Dickson et al.27 N/A Oligonucleotides See Table S1 for oligonucleotide sequences N/A N/A Recombinant DNA pLEX_307 Gift from David Root Addgene Plasmid #41392; RRID:Addgene_41392 pInducer20 Gift from Stephen Elledge Addgene Plasmid #44012; RRID:Addgene_44012 psPAX2 Gift from Didier Trono Addgene Plasmid #12260; RRID:Addgene_12260 pMD2.G Gift from Didier Trono Addgene Plasmid #12259; RRID:Addgene_12259 pDONR221 GFP Gift from David Root Addgene Plasmid #25899; RRID:Addgene_25899 pDONR221 NLRP1 Hollingsworth et al.9 Addgene Plasmid #166823; RRID:Addgene_166823 pDONR221 NLRP1 (NLRP1 residues 229-990) Ball et al.13 N/A pDONR221 NLRP1B Chui et al.7 N/A pDONR221 NLRP1-W430G This Study N/A pDONR221 NLRP1-C427S This Study N/A pDONR221 NLRP1-C529A This Study N/A pDONR221 NLRP1-C754S This Study N/A pDONR221 NLRP1-C757S This Study N/A pDONR221 NLRP1B-C225S This Study N/A pDONR221 NLRP1-C427S (NLRP1 residues 229-990) This Study N/A pLEX307 GFP-FLAG This Study N/A pLEX307 NLRP1-FLAG Hollingsworth et al.9 N/A pLEX307 NLRP1-FLAG (NLRP1 residues 229-990) Ball et al.13 N/A pLEX307 NLRP1B-FLAG Chui et al.7 N/A pLEX307 NLRP1-W430G-FLAG This Study N/A pLEX307 NLRP1-C427S-FLAG This Study N/A pLEX307 NLRP1-C529A-FLAG This Study N/A pLEX307 NLRP1-C754S-FLAG This Study N/A pLEX307 NLRP1-C757S-FLAG This Study N/A pLEX307 NLRP1B-C225S-FLAG This Study N/A pLEX307 NLRP1-C427S-FLAG (NLRP1 residues 229-990) This Study N/A pInducer20 NLRP1-HA This Study N/A pInducer20 NLRP1-C427S-HA This Study N/A pInducer20 NLRP1-D413A-HA This Study N/A pInducer20 GFP-HA This Study N/A Software and algorithms AlphaFold-Multimer Cianfrocco et al.31 cosmic-cryoem.org GraphPad Prism Version 9 GraphPad Software graphpad.com R version 4.3.2 CRAN cran.r-project.org RStudio 2023.03.0 Posit posit.co/products/open-source/rstudio MaxQuant 2.1.0 MaxQuant maxquant.org Pymol Schrödinger https://pymol.org/2/ ..

Article Title: Activation of the CARD8 Inflammasome Requires a Disordered Region.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies GSDMD Rabbit polyclonal Ab Novus Biologicals Cat# NBP2-33422; RRID:AB_2687913 GSDMD Rabbit monoclonal Ab Abcam Cat# ab209845; RRID:AB_2783550 FLAG M2 monoclonal Ab Sigma Cat# F3165; RRID:AB_259529 CARD8 C terminus Rabbit polyclonal Ab Abcam Cat# ab24186; RRID:AB_2275096 CARD8 N-terminal Rabbit polyclonal Ab Abcam Ab194585 GAPDH Rabbit monoclonal Ab Cell Signaling Tech Cat# 2118; RRID:AB_561053 MTMR1 Abcam Ab240569 D2HGDH Abcam Ab233516 ATF-3 Cell Signaling Tech Cat# 33593; RRID:AB_2799039 IGBP1 Cell Signaling Tech Cat# 5699; RRID:AB_10897328 SMAD9 Abcam Cat# ab124094; RRID:AB_10971189 ARF1 Abcam Cat# ab58578; RRID:AB_879566 ACTR5 Proteintech Cat# 21505-1-AP; RRID:AB_10733470 AKAP8 Abcam Cat# ab72196; RRID:AB_1267650 GSTP1 Cell Signaling Tech Cat# 3369; RRID:AB_2279558 SET Abcam Cat# ab1183; RRID:AB_298611 NLRP1B Vance Laboratory 2A12 IRDye 800CW anti-rabbit LICOR Cat# 925-32211; RRID:AB_2651127 IRDye 800CW anti-mouse LICOR Cat# 925-32210; RRID:AB_2687825 IRDye 680CW anti-rabbit LICOR Cat# 925-68073; RRID:AB_2716687 IRDye 680CW anti-mouse LICOR Cat# 925-68072; RRID:AB_2814912 Chemicals, Peptides, and Recombinant Proteins Val-boroPro (VbP) Okondo et al., 2017 N/A Bortezomib (Bort) MilliporeSigma 504314 MLN4924 Cayman 15217 bestatin methyl ester (Me-Bs) Sigma 200485 Sequencing grade modified trypsin Promega V5113 Proteinase K (PROK) Invitrogen 25530049 FuGENE HD Promega E2311 TMTsixplex Isobaric Label Reagents ThermoFisher Scientific 90061 Critical Commercial Assays MycoAlert Mycoplasma Detection Kit Lonza LT07-318 DCA Protein Assay kit Bio-Rad 5000111 Pierce LDH Cytotoxicity Assay Kit Life Technologies PI88953 Deposited Data TMT proteomics raw data This paper ProteomeXchange PXD015978 RNA-seq raw data This paper GEO GSE153744 Experimental Models: Cell Lines Human HEK293T ATCC CRL-3216 Human HEK293T CASP1/GSDMD Johnson et al., 2018 N/A Human THP-1 ATCC TIB-202 Human THP-1 CARD8 KO Johnson et al., 2018 N/A Human THP-1 CARD8 KO + GFP This paper N/A (Continued on next page) Cell Reports 33, 108264, October 13, 2020 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Human THP-1 CARD8 KO + CARD8 This paper N/A Human THP-1 CARD8 KO + CARD8 ZUC This paper N/A Human THP-1 CARD8 KO + GFP-CARD8 ZUC This paper N/A Human THP-1 CARD8 KO + V5-GFP-CARD8 ZUC This paper N/A Human THP-1 CARD8 KO + MTMR1(M1-Q94)-CARD8 ZUC This paper N/A Human THP-1 CARD8 KO + D2HGDH(M1-R51)-CARD8 ZUC This paper N/A Human OCI-AML2 DSMZ ACC 99 Human MV-4-11 DSMZ N/A Mouse RAW 264.7 ATCC TIB-71 Oligonucleotides Primer for CARD8 FL: ATGGAAAAAAAGGAGTGTCCAG This paper N/A Primer for CARD8 ZUC: atggggcctgaaggaaatgtggatg This paper N/A Primer for CARD8 G131M-537: ATGGACATTTGCTCAGAAGAG This paper N/A Primer for CARD8 K147M-537: atgGTCTGTTTTGAGATCGAAG This paper N/A Primer for CARD8 F150M-537: ATGGAGATCGAAGAAGATTATAAAAATCG This paper N/A Primer for CARD8 E153M-537: ATGGAAGATTATAAAAATCGTCAGTTTCTG This paper N/A Primer for CARD8 Y156M-537: ATGAAAAATCGTCAGTTTCTGGGG This paper N/A Primer for CARD8 K157M-537: atgAATCGTCAGTTTCTGGG This paper N/A Primer for CARD8 UPA-CARD: atgcgcctctccatccccatcac This paper N/A sgRNA target sequence for CARD8: TGACGATTGCGTTTGGTTCC Johnson et al., 2018 N/A Recombinant DNA pLEX_307 Gift from David Root Addgene Plasmid Cat #41392 MTMR1 Origene RC212024 D2HGDH Genscript OHu27566 pEGFP-GFP11-Clathrin light chain Gift from Bo Huang Addgene Plasmid Cat #70217 pcDNA3.1-GFP(1-10) Gift from Bo Huang Addgene Plasmid Cat #70219 pLEX_307_CARD8 (and truncations) This paper N/A pLEX_307_HA-GSSGnx-CARD8 ZUC This paper N/A pLEX_307_GFP-CARD8 ZUC This paper N/A pLEX_307_V5-GFP-CARD8 ZUC This paper N/A pLEX_307_GFP(1-10)-CARD8 ZUC This paper N/A pLEX_307_MTMR1(M1-Q94)-CARD8 ZUC This paper N/A pLEX_307_MTMR1 This paper N/A pLEX_307_MTMR1D1-94 This paper N/A pLEX_307_D2HGDH This paper N/A pLEX_307_D2HGDHD1-51 This paper N/A Software and Algorithms GraphPad Prism Version 7 GraphPad Software https://www.graphpad.com/ ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ Proteome Discoverer version 2.2.0.388 Thermo Fisher Scientific OPTON-30945 ..

Plasmid Preparation:

Article Title: The hydrophobicity of the CARD8 N-terminus tunes inflammasome activation.
Article Snippet: Article The hydrophobicity of the CARD8 N-terminus tunes inflammasome activation

Software:

Sequencing:

other:

Article Title: ER-phagy and proteostasis defects prime pancreatic epithelial state changes in KRAS-mediated oncogenesis.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER pDONR223 Reg3b ΔN; Mouse Reg3b cDNA (ΔG27-R37) This paper N/A pDONR223 Reg3b KDEL; Mouse Reg3b fused to C-terminal KDEL motif This paper N/A pDONR223 Reg3d; Mouse Reg3d cDNA This paper N/A pDONR223 Reg3g; Mouse Reg3g cDNA This paper N/A pDONR223 STOP This paper N/A scAAV Reg3b; Mouse Reg3b cDNA This paper N/A scAAV Reg3b ΔN; Mouse Reg3b cDNA (ΔG27-R37) This paper N/A scAAV Luciferase-V5; Firefly luciferase cDNA This paper N/A pDONR223 STOP This paper N/A pcDNA3.2 V5; Empty vector control This paper N/A pcDNA3.2 Reg3b; Mouse Reg3b cDNA This paper N/A pcDNA3.2 Reg3b ΔN; Mouse Reg3b cDNA (ΔG27-R37) This paper N/A pcDNA3.2 Reg3b KDEL; Mouse Reg3b fused to C-terminal KDEL motif This paper N/A pLX304 DEST V5 A gift from David Root Addgene Plasmid #25890 pLX304 DEST Reg3a-GFP; Mouse Reg3a cDNA This paper N/A pEGFP DEST C1 Smith et al. 36 N/A pEGFP; GFP only control This paper N/A pEGFP Reg3a; Mouse Reg3a cDNA This paper N/A pEGFP Reg3b; Mouse Reg3b cDNA This paper N/A pEGFP Reg3d; Mouse Reg3d cDNA This paper N/A pEGFP Reg3g; Mouse Reg3g cDNA This paper N/A pDONR223 Ccpg1 FL; Mouse Ccpg1 fulllength (1-753) Source Bioscience Cat# IRAVp968H01136D pDONR223 Ccpg1 NTD-TM; Mouse Ccpg1 (1-239) This paper N/A pDONR223 Ccpg1 ΔNTD; Mouse Ccpg1 (215-753) This paper N/A pDONR223 Ccpg1 ΔL1; Mouse Ccpg1 (1-359;582-753) This paper N/A pDONR223 Ccpg1 ΔL2; Mouse Ccpg1 (1-581) This paper N/A pDONR223 Ccpg1 ΔNTD ΔL2; Mouse Ccpg1 (215-581) This paper N/A pDONR 223 Fam134b; Mouse Fam134b Source Bioscience Cat# IMAGp998H0714447Q and IRAVp968B0235D pDONR 223 Fam134c; Mouse Fam134c Source Bioscience Cat# IRAVp968B0736D pDONR 223 Sec62; Mouse Sec62 Source Bioscience Cat# IRAVp968D06104D pDONR 223 SQSTM1 (p62); Human SQSTM1 Gift from Christian Behrends 78 N/A pDONR 223 Calcoco1; Mouse Calcoco1 Source Bioscience Cat# IRAVp968B12130D pLX304-EV; Empty lentiviral vector This paper N/A pLX304 Ccpg1-V5; Mouse Ccpg1 fulllength (1-753) This paper N/A pcDNA myc(6) DEST Created by F. Van Roy and B. Janssens, Ghent University, Belgium BCCM plasmid #LMBP 7212 pcDNA myc(6) EV; Empty vector control This paper N/A (Continued on next page) Developmental Cell 60, 1–18.e1–e13, December 15, 2025 e5

Review